Siirry sisältöön

Viikonlopun bonuksena pieni genetiikka-annos. Tutkitaan VGL-geenilaboratorion monimuotoisuustestin toistojaksoja.

Koiralla on arviolta 19 000 geeniä, joten on epätodennäköistä, että juuri nämä testiin valitut toistojaksot olisivat markkereita geenialueelle, jolla sijaitsee jokin samanperintäinen geenivirhe. Silti. Kun tällainen geenitason tutkimustulos nyt on olemassa, niin katotaan sitä tarkemmin.

Jos Entsyymin geenitestipaneelista poimitaan sukusolujen geeniloton takia samanperintäisiksi muuttuneet toistojaksot, jää jäljelle rinkuloidut:

...mikä on hieman creepyä, koska tuossa olisi mun vakiolottorivillä 4 oikein.

Sitten mennään geenilabran shibatietokannasta katsomaan, miten yleisiä tai harvinaisia rodussa on nuo Tsyymin versiot. Tällä hetkellä versioiden yleisyydet perustuvat 159 testattuun shibaan. Testissä ei muuten mitenkään varmennettu sitä, että lähetetty näyte on puhdasrotuisesta shiba inusta. On käynyt mielessä, että mahtaako ne kaikkein heterotsygoottisimmat yksilöt olla jenkkien takapihakasvatuksen koiria, joissa on ollut mukana ns. uutta verta. Statsisivu löytyy täältä: https://vgl.ucdavis.edu/canine-genetic-diversity/shiba-inu/stats

2 (AHT137) 145/145 0.101
6 (AHTk211) 91/91 0.343
7 (AHTk253) 292/292 0.097
8 (C22.279) 120/120 0.217
18 (REN162C04) 210/210 0.352
21 (REN247M23) 270/270 0.531
22 (REN54P11) 238/238 0.198
29 (VGL2009) 15/15 0.085

Suluissa on toistojaksojen viralliset nimet, joita tarvitaan kohta. Perässä on kunkin version yleisyyslukema tutkituissa shiboissa. Maksimi olisi 1.000, jolloin kaikilla shiboilla olisi kyseinen versio tuplana, eikä muita versioita olisi lainkaan. Koska shiboja on mukana 159 ja jokaisella on 2 kpl jokaista toistojaksoa, tarkottaisi yhdestä shibasta vain yhtenä kopiona löytynyt versio yleisyyttä 1 (159 x 2) = 0.003. Muutamia tuollaisia taulukossa todella näkyy. Jos yleisyyslukema on 0.1:n pintaan, niin versiota on löytynyt 8-16 shibalta. Koska Tsyymin harvinaisimmat markkerit kiinnostaa (joskin näidenkin yleisyys on mielestäni liiallinen), niin valitaan jatkoon nuo kolme boldattua toistojaksoa:

AHT137

AHTk253

VGL2009

Missä te sijaitsette koiran genomissa ja onko aivan naapurissanne jotain tunnettuja geenejä? Kirjoitan tätä on the go, joten en itekään vielä tiedä, miten juttu etenee.

No niin, löytyi taustatietoa geenitestin markkereille. Kyseessä on International Society for Animal Geneticsin (ISAG) suosittelema testipaneeli koirien polveutumismäärityksiin. Lisäksi VGL-nimiset markkerit on labran omia, uudempia markkereita. Tsyymin kaks kiinnostavaa ahtimarkkeria on listattu. Nyt selvisi, että ne sijaitsevat koiran kromosomeissa (Canis FAmiliaris) numero 23 ja 11. Mutta löytyykö tarkempaa sijaintia...

PubMedin alaosioista löytyi koiran genomi interaktiivisessa muodossa. Nyt kun tiietään, mistä kromosomeista hakea, niin...

Niin ei löydy vielä mitään. Joko markkereiden lokuksia ei ole merkitty tuonne tai ne on siellä jollain muulla nimellä. Katsotaan saataisiinko muualta selville tarkempi numerollinen "osoite" noille markkereille. Tuo genomihäkkyrä näyttää kauhistuttavan sekavalta.

Vaihdetaan lähestymistapaa. Aikasemmassa taulukossa oli muutakin arvokasta tietoa kuin kromosomien nimet. Nimittäin alukesekvenssit. Markkerin lähellä DNA:n kirjaimet on nuo, mitä forward sequence -sarakkeessa lukee. Netistä löytyy hauska työkalu nimeltä BLAST, jota kuka tahansa voi käyttää. Jos löydät jostain pätkän DNA:ta tai proteiinia ja haluat tietää, mistä eliöstä se on peräisin, niin heität sekvenssin tänne ja painat "Blast!"

Käskin sen etsiä koiran geeneistä, ettei haku kestäisi liian pitkään. Ja mitä löytyi...

Täydellinen mätsi kromosomista 11 kuten pitikin! Nyt tiiämme markkerin summittaisen sijainnin kromosomissa: 2743998. Tätä pitäisi voida hakea äskeisessä genomiselaimessa. Samalla paikkatiedolla löytyy kuitenkin ihan eri sekvenssi. Genomiselaimen DNA on vissiin Tasha-bokserin referenssigenomi, ja tämä on ollut labbis. MUTTA, selvisi samalla, että referenssigenomistakin voi hakea DNA:n kirjaimilla. Täältä löytyi AHT137-markkerin aluke, eli markkerin pitäisi sijaita jompaan kumpaan suuntaan tuosta. Mä en tiedä, että kumpaan, joten huomioidaan molemmat suunnat.

Zoomataan etemmäs ja katotaan, asuuko naapurustossa tunnettuja geenejä.

Onhan niitä. En tiiä, miten kaukana markkerista joku geeni voi vielä sijaita, että se periytyy sukusolujen muodostuessa yhessä markkerin kanssa eikä crossing over -ilmiö erota niitä toisistaan. Varmaan ainakin tuon alarivillä sijaitsevan PROP1-geenin etäisyydellä, koska siitä on tutkimus, jossa mainitaan AHT137-markkerin läheisyys: https://pubmed.ncbi.nlm.nih.gov/10773688/ . Naapurigeenejä:

  • Sammuneita pseudogeenejä.
  • Tuntematonta proteiinia tuottavia tuntemattomia geenejä.
  • Hajureseptorigeeni.
  • CLK4. Aktivaattoriproteiini, saattaa liittyä geeninsäätelyyn. Yhdistetty Fanconin anemiaan.
  • COL23A1. Kollageenin alayksikkö.
  • Äskeinen PROP1. Hormonitoimintaan vaikuttava geeninsäätelyproteiini.
  • Neljä eri sinkkisormiproteiinia. Niissä kaikissa sojottaa sormen näkönen uloke, jossa on aktiivisessa kohdassa sinkkiatomi. Geeninsäätelyproteiineja. Yhdistetään mm. hämäräsokeuteen ja selkärankareumaan.
  • PHYKPL eli 5-fosfohydroksyyli-L-lysiinifosfolyaasi. Kuulostaa hyvältä ja tekee jotain mitokondrioissa.
  • GRM6. Glutamaattireseptori. Liittyy keskushermoston toimintaan.
  • ADAMTS2. Liittyy kollageenin muodostumiseen.

Sama toiselle markkerille AHTk253, välivaiheet skipattu

Naapurigeenejä:

  • EXOG. Proteiini, joka pystyy katkaisemaan DNA:n.
  • ACVR2B. Kasvutekijäreseptori.
  • XYLB. Perusmetabolian entsyymi.
  • Kaksi kanavaproteiinia, joiden kautta aineet pääsevät kalvon läpi.
  • SCN5A. Sydänlihaksen supistumiseen liittyvä ionikanavaproteiini.
  • OXSR1. Hapetusvaurioihin reagoiva säätelyproteiini.
  • MYD88. Immuunijärjestelmän toimintaan liittyvä proteiini.

Ja vielä kolmannelle markkerille VGL2009

Tämän primeri ccatttaccagaatttgaagctg oli kehitetty paperissa Developmental validation of DogFiler, a novel multiplex for canine DNA profiling in forensic casework. Primeri sijaitsee tarkotuksella etempänä varsinaisesta toistojaksosta. Toistojakson sijainniksi on suoraan merkitty 20: 9290711, joten katsotaan, mitä tuon kohdan ympäriltä löytyy.

  • Oksitosiinireseptori.
  • RAD18. Liittyy DNA-vaurioiden korjaamiseen.
  • Mitokondrion energiantuotantokoneiston proteiini.
  • Kaveoliini. Solukalvoproteiini, joka liittyy siihen, miten solu ottaa tavaraa sisäänsä.

Siinä viikonlopun genetiikkabonus. Idea ja mahdollisuudet tuli toivon mukaan esille, analyysistä en mee niin takuuseen.


Hankin Entsyymille tarkemman monimuotoisuustestin VGL Davis -labrasta.


Onkohan shiba taas kerran historiansa aikana liian sisäsiittoinen koirarotu.


Entsyymi, jonka vanhemmat on tuontikoiria eri maista ja eri maanosista ja paperilla täysin eri sukuja ainakin kuuden sukupolven tunnettujen koirien päähän, on silti geenitestin perusteella käsittämättömän samanperintäinen. Tuollainen tulos vastaa ei-sisäsiittoisilla kyläkoirilla sitä, että emo ja isä on täyssisarukset. Sisko ja veli. Vanhemmat voi olla kumpikin ite vaikka täysin eriperintäisiä mutta silti keskenään "puoliksi samanlaisia". Tyypillisesti aikasempien vuosikymmenten matadoruroksien vaikutuksen takia. Sitten jälkeläinen onnistuu perimään just ne samanlaiset geenit molemmilta, kun puolet vanhempien geeneistä on arvottu sukusoluihin.


Miltä ne KoiraNetin oranssilla tavalla sisäsiittoiset shibat jo pahimmillaan näyttää? Entsyymi on taatusti isänsä tytär, enkä mä pidä realistisena sitäkään, että aikasemmissa lähisukupolvissa ois vääriä polveutumisia tai joku puuttuvista esivanhemmista molemmin puolin. Vaikka melkein toivoisin että olisi. Käppyrän punainen viiva näyttää ilmeisesti kaikkien testin olemassaolon aikana testattujen shibojen sisäsiittoisuuden jakauman. En ole varma, miten tuo on skaalattu (ainakaan nolla ei voi tarkottaa 0% sisäsiittoisuutta). Ehkä nykyisin testattavat nuoret koirat alkaa saada väistämättä "most inbred"-pään tuloksia sitä mukaa kun se kanta kerran väistämättä sukulaistuu.


STR-taulukossa on mitattu emolta ja isältä perittyjen toistojaksojen pituuksia. Toistojaksot ei ole geenejä mutta niitä on helppo tutkia ja niiden perusteella voi päätellä jotain geeneistä. Rankasti yksinkertaistettu idea: jokainen shiba-rodun kantakoira/matadoruros on jättänyt rotuun tietyn pituiset toistojaksot. Sekä muut geeninsä. Jos nykyinen shiba on perinyt saman pituisen toistojakson sekä emon että isän kautta, niin sitten se on voinut periä tuplana myös jonkin geenin tältä kantakoiralta/matadorilta. Just sillä tavalla kaikista pienistä japanilaiskoirista sata vuotta sitten tehtiin shiban näkösiä, kun rotua alettiin ekaa kertaa ulkomuotojalostaa. Hienompi termi tälle oli rotutyypin vakiinnuttaminen. Mutta samalla ongelmana on tuplana perityt huonot geenit, koska niidenkin vaikutus tulee sillon herkemmin näkyviin.


Sukupuusta lasketun sisäsiitosprosentin määritelmä: laskennallinen todennäköisyys, että koira on perinyt jonkin esivanhempansa geenin (tai toistojakson) tuplana sekä emon että isän kautta. Entsyymillä nolla prosenttia, aivan kuten geenitestissä ei näy. Onko noilla 4-6 sukupolven sisäsiitosprosenteilla enää mitään merkitystä, jos koirat alkaa kuitenkin oikeasti olla yhtä ja samaa. Koujinryuun ja Gomaryuun tiivistävää vaikutusta ootellessa hatunnosto niille, jotka vielä jaksaa ja tohtii pitemmällä tähtäimellä yrittää.

Immuunijärjestelmän DLA-geenialuetta. Tän pitäisi olla nisäkkään monimuotoisin geenialue. Haplotype 1 on peritty toiselta vanhemmalta ja haplotype 2 toiselta. Mä oon alkanut miettiä, voisko nuo 1054 ja 2106 olla shiballa jotain riskiversioita allergioille. Kolmasosalla kaikista shiboista on nuo. Myös Tiikerillä. Tsyymi ei vielä kutise ja on yli atopian pahimman riski-iän mutta ihan samaa mä sanoin viimeksi liian aikaisin Tikrusta.


Ai niin, nuo 1054 ja 2106 on labran omia koodeja. Ne näyttää diplomissa selkeämmiltä kuin joku DLQ-DBR 2678:24589:120 mutta niistä on turha yrittää ettiä tutkimustietoa. En edelleenkään tiiä avataanko koodausta jossain.


Vaikka tulos oli shibojen kannalta aika karsea, niin olin oikeasti dyskinesiajuttujen ja Entsyymin pentujen takia iloinen että nimenomaan Tsyymi on geenitestissä näin samanperintäinen. Vaikka sukupuu näyttää ulkosiitetyltä niin uskon taas siihen, että jokin resessiivinen periytymistapa voi myös selittää sen. Dyskinesia ei alkujärkytyksen jälkeen ole vaikuttanut elämään mitenkään, koska kohtauksia ei ole enää näkynyt. Mutta kukaan ei vielä tiedä, miten se pitemmän päälle käyttäytyy.

Tl;dr: Shiba-rotu on niin sisäsiittoinen, että KoiraNetin sukutaulun perusteella täysin ei-sukulaiset shibavanhemmat voi olla geenitasolla kuin sisko ja veli.

Kierrätyskuva, mutta sopii hyvin aiheeseen. Mä olen aivan varma, että Entsyymin geneettisen koostumuksen voisi osittain jäljittää 1950-luvun Hama Go -kantashibaan. Tämähän se rotujen alkuperäinen idea on, vaikka nykyisin puhutaan lähes pelkästään huonoista geeneistä.


Jos oman shiban monimuotoisuus tai mahdollinen geneettinen harvinaisuus kiinnostaa, niin VGL-laboratorion monimuotoisuuskartoituksen ja poskisolunäytteen testiharjat voi tilata noin 80 dollarilla täältä: https://vgl.ucdavis.edu/. Sivustolle pitää rekisteröityä. Poskisolunäyte on kuin huulen ja ikenen välistä otettava koronatesti. Varmimmin harjoihin tarttuu riittävästi soluja, jos näytteen ottaa eläinlääkäri samalla kun koira on muutenkin rauhoitettu.


Tärkeää asiaa näytteen postituksesta Yhdysvaltoihin


Biologista materiaalia sisältävät näyteharjat pitää lähettää tavarakirjeenä postitoimipisteessä. Postilaatikkoon jätettynä tulee kuulema bumerangina takaisin. Syy: USA:n tulli. Näyteharjojen mukana tullut infolappu pitää täyttää ja teipata kirjekuoren toiselle puolelle. Kirje myös rekisteröidään sähköisesti USA:n tullia varten ja siihen liimataan viivakoodilipuke. Omalle kirjeelleni tuli postimaksua 5 euroa. Tullausjutut ei maksa mitään. Labran osoitteen postinumero on sitten niin erikoinen että sitä ei löytynyt postitoimiston tietokoneelta vaan piti syöttää se manuaalisesti. Laitoin sisällöksi "Other" ja "Dog DNA sample" ja arvoksi 0. Sain kuittauksen näytteen saapumisesta perille 9 päivää postituksesta, ja sen jälkeen tulokset ilmestyivät sähköpostiin 12 päivässä.

Entsyymin lohjennut hammas innoitti penkomaan lisää sen erikoisesta geenitestituloksesta. Kun testautin Tsyymin geenit aikoinaan MyDogDNA:lla, ilmestyi raporttiin mitä omituisin tulos.

Testin mukaan mun kaunis, siro shibani on lyttykuonoisuuden SMOC2-geenivariantin kantaja xD

Shiba nyt on vihonviimeinen rotu, jossa odottaisin moista näkeväni, ja puikkokuonoinen Entsyymi kaikkein vähiten. Mitä ihmettä geenitesti on tunnistanut, ja jos testitulos on todellinen, niin voiko asialla olla shiboille jotain merkitystä?

Ja minkälainen on homotsygootti SMOC2-shiba? Jos rodussa oikeasti esiintyy tuota varianttia, niin homotsygoottejakin voi olla olemassa. Tuskin ne lyttynaamoja sentään on, mutta heräsi ajatus, että voisiko kuonon luuston osa nimeltä hampaisto liittyä asiaan. Seuraa villiä spekulointia.

"Lyttynaamageeni" SMOC2

Brakyrodut ja SMOC2:n yhdistänyt tutkimusjulkaisu on vuodelta 2017. Muistan, että siitä kohistiin hetken ja popularisoinnit otsikoitiin, että nyt selvisi mikä tekee mopsista mopsin. Tutkimuksen otsikko on Canine Brachycephaly Is Associated with a Retrotransposon-Mediated Missplicing of SMOC2. Huomaa tieteen vakioilmaisu "associated with" ja sen merkitys.

Tutkimuksessa on mittailtu eri rotujen kalloja ja tarkasteltu niiden genomeja. (Hyppäys teknisten yksityiskohtien yli.) Monia lyhytkalloisia koiria on yhdistänyt se, että niiden SMOC2-geenistä on löytynyt ylimääräinen osa. Keskelle geeniä on pamahtanut palanen hyppivää geeniä, eli tuo tutkimuksen otsikossa mainittu retrotransposoni. Merle-värin yhteydessä on blogissa aiemmin puhuttu hyppivistä geeneistä.

Ja laboratoriokokeissa on todettu, että mutaation takia geenistä valmistuu ehjää lähetti-RNA:ta paljon vähemmän. Lähetti-RNA on se rakennusohje proteiinille, välivaihe geenin ja sen koodittaman proteiinin välillä. Tutkimuksessa ei mitattu, väheneekö myös SMOC2-proteiinin määrä eikä tutkittu, kasvaako lyttykuonoiselle rodun pennulle kuono, jos SMOC2-geenin mutaatio korjataan. Mutta kyllähän lähetti-RNA:n määrästäkin voi jotain päätellä. Lisäksi mutaation vaikutus näytti kertyvän, eli lyhytkuonoisimmat oli homotsygootteja ja hiukan lyhenneet kuonot heterotsygootteja.

SMOC2-variantti normikuonoisilla harvinainen mutta ei mahdoton

Tutkimuksessa oli mukana lähes 500 koiraa, sekä rotuja että monirotuisia. Rodut ei sinänsä merkinneet vaan kaikkien koirien päät mitattiin erikseen. SMOC2-variantin yleisyys eri pituisillla kuonoilla (0.0 = keskipituinen kuono) näytti tältä. Pylväiden korkeus kuvaa sitä, miten monella koiralla, jolla tietyn pituinen kuono, on ollut SMOC2-variantti. Valkoiset on mutaatiovariantista vapaita, harmailla on se heterotsygoottisena vain toisessa vastinkromosomissa, ja mustilla on pelkkää mutaatiovarianttia. Shiboja ei osunut mukaan tutkimukseen, mutta normikuonoiset tai vähän pitempikuonoisetkin koirat on voineet olla kantajia. Eli ei ole mahdoton ajatus, että shiban kaltaisella koiralla voisi oikeasti olla tuota SMOC2-varianttia. Tekeekö se niille mitään, se on sitten eri juttu. Käppyrässä lähes keskikohdassa näyttää olevan yksi "musta" koira. Geenit ja biologia on monesti tämmösiä.

"SMOC2-variantti selittää niin ja niin monta prosenttia lyttynaamaisuudesta." = hienompi numeerinen ilmaisu sille, ettei asia ole yksinkertaisesti joko-tai, kuten taulukon pylväiden väreistäkin näkyy.

Yksityiskohta kuvasta (c) Marchant et al: Canine Brachycephaly Is Associated with a Retrotransposon-Mediated Missplicing of SMOC2. Curr Biol. 2017 Jun 5;27(11):1573-1584.e6. doi: 10.1016/j.cub.2017.04.057. Epub 2017 May 25. PMID: 28552356; PMCID: PMC5462623.

Mitä SMOC2-proteiini tekee?

Sillä on ihan hirveä kokonainen nimi. SMOC2 = SPARC related modular calcium binding 2. Sparcinsukuinen moduulillinen kalsiuminsitoja 2. Se ei työskentele soluissa vaan solujen välisessä tilassa ja liittyy ainakin siihen, miten solut kiinnittyvät kudoksessa ja milloin ne jakaantuvat. Erityisesti SMOC2:sta on rikastunut luuytimen, paksusuolen ja hammasluun kantasoluihin. Koirien lisäksi kaloilla ja ihmisillä on havaittu SMOC2-mutaatioiden yhteys kasvojen luiden kehityksen häiriöihin. Ihmisillä myös hammasongelmiin, ja tämä on nyt se, mihin tietty kiinnitin huomiota, kun puhe on shiboista. Ihmisillä SMOC2 yhdistetään näköjään myös glaukoomaan eli silmänpainetautiin. Kiinnostavaa, koska sitäkin japanilaisilla shiboilla raportoitiin vuosituhannen alussa. SMOC2 on tuollainen "yleisproteiini", josta on paljon tutkimuksia. Poimin tähän ns. kirsikoita shiboille.

Shibojen historiallisen huonot hampaat

Shiba-rodulla on ollut viimeisen sadan vuoden aikana monta geneettistä pullonkaulavaihetta. Joko koiria on ollut olemassa tosi vähän tai ne on sisäsiitoksella ajettu tilanteeseen, jossa melkein kaikilla shiboilla on ollut tyyliin yhdeltä tai kahdelta shibalta lähtöisin olevat geenit. Ja samalla niiden geenivirheet. 60-luvun japanilaisessa koirakirjassa:

Google Lens -käännös joo. Muistan, että yritin kattoa noita käännöksiä niin monella tavalla kuin pystyin. "Alahampaat" = andaashotto = undershot = alapurenta ja hammaspuutokset tulkintani mukaan mainittu. Sitten oli NIPPO:n vuosikirjojen taulukot, joiden perusteella shiboilta kerta kaikkiaan puuttui 70-luvulla hampaat suusta.

Johtuu ehkä kuvasta, mutta oon aina pitänyt Benimarun emon (vasen) leukoja hieman erikoisina.

NIPPO on kuulemma näyttelyissään nykyisin tarkka siitä, että hampaisto on kunnossa. Hammastodistukset ei merkitse mitään, ja irronnut hammas on yhtä paha kuin syntyjään puuttuva hammas. Tekisi mieli ajatella, että koiranäyttelyt on kerrankin edistäneet rodun terveyttä, jos huonojen hampaiden geenit on saatu vähenemään.

Mitä jos tuo SMOC2-variantti on shiboissa todellinen ja ollut aiemmin yleisempi ja ilmennyt purennassa ja hampaissa.

Mistä päädytään siihen, mistä koko juttu inspiroitui: Tsyymin purukalustoon. Siinä missä Tiikerillä on 7-vuotiaana röntgenkuvissakin vahvat ja ehjät hampaat, on Tsyymillä jo 5-vuotiaana kaksi murtunutta hammasta. Ja Tsyymin geeneistä testi tosiaan havaitsi tuon SMOC2-variantin. Tiikerillä sitä ei ole. Otoskoko kaksi shibaa ei tietenkään riitä mihinkään.

Shiban SMOC2-variantti - totta vai tarua?

Jos lyttynaamainen shiba ei jo herätä epäilyksiä, niin pari muuta juttua pitää huomioida. Hauska testitulos on voinut olla false positive, kuten koronan PCR-testistä on voinut saada väärän positiivisen. MyDogDNA näyttäisi olevan edelleen ainoa geenitestifirma, jonka testipaneelissa SMOC2 mainitaan (kohdassa short snout), eli olisiko variantti hankalampi tapaus testauksen kannalta. Toinen, ehkä vielä tärkeämpi asia, on tuo SMOC2-tutkimus itsessään. Se jää mielestäni vähän... kehityskelpoiseksi, mutta kuudessa vuodessa ei silti ole julkaistu aihetta syventäviä jatkotutkimuksia. Ei välttämättä merkitse mitään, mutta herättää itelläni kysymyksiä.

Asiaa olisi yhtä kaikki kiinnostava selvittää enemmän. Onko shiballasi geenitestituloksena lyhytkuonoisuuteen yhdistyvän SMOC2-variantin kantajuus, ja jos on, niin onko sillä puuttuvat tai jotenkin epätavallisen huonot tai herkästi murtuvat hampaat? Tai toisin päin - huonot hampaat mutta ei SMOC2-varianttia geenitestissä?

"Meiltäkin puuttuu nenät. Arvaa johtuuko se geenistä."


Lähteitä ja luettavaa:

Canine Brachycephaly Is Associated with a Retrotransposon-Mediated Missplicing of SMOC2 (Marchant ym., 2017)

Deficiency of the SMOC2 matricellular protein impairs bone healing and produces age-dependent bone loss (Morkmued ym., 2020)

Smoc2 modulates embryonic myelopoiesis during zebrafish development (Mommaerts ym., 2014)

Homozygosity mapping and candidate prioritization identify mutations, missed by whole-exome sequencing, in SMOC2, causing major dental developmental defects (Bloch-Zupan ym., 2011)

The SPARC-related modular calcium binding protein 2 (SMOC2) gene polymorphism in primary glaucoma: a case-control study (Al-Dabbagh ym., 2016)

Kuvituskuvina 60/70-luvun taitteen japanilaisia shiboja kirjasta 日本犬.

Sainpas tähänkin otsikkoon alkusoinnun. Viikonlopun blogijuttu inspiroitui vahingossa, kun kävin katsomassa, mitä "shiballa on japaninsuden geenejä" -tutkimukselle oikein kuuluu. Sitä ei ole vieläkään julkaistu virallisesti. Mutta samalla löytyi uusi japanilainen paperi eri koirarotujen immuunigeeneistä. Mukana on ollut myös 37 shibaa, 10 akitaa ja 1 shikoku.

Shiboilla tuntuu olevan ihan liikaa allergioita ja atopiaa. Jutunaiheet lenkeillä on yhtä mieltäylentäviä. "Ai teille annettiin Apoquel, meillä menee tuo perinteinen kortisoni!" Mulla Tiikeri syö nyt ainakin kesäajan kortisonia siitepölyallergiaan. Tehoaa hienosti kutinaan mutta ei liene pitemmän päälle kovin terveellinen lääke.

Allergia, atopia ja autoimmuunisairaudet syntyvät siitä, kun immuunijärjestelmä alkaa toimia epätarkoituksenmukaisella tavalla. Koska nämä esiintyvät usein roduittain eli vaikuttavat geneettisiltä, niin immuunijärjestelmän geenien yhteyttä häiriöihin on selvitetty hartaasti. Tutkituin immuunigeenialue on nimeltään DLA (dog leukocyte antigen). Sillä on monia kiinnostavia piirteitä.    

Koiran DLA-immuunigeenialue, simppeli versio

  • Peräkkäisten geenien rypäs kromosomissa 12.
  • Immuunigeeneistä valmistuu erilaisia pikkuproteiineja, joiden tehtävänä on napata ja esitellä pöpöjen osia puolustussoluille. Esimerkiksi viruksen valtaaman solun pinnalla on tällanen pikkuproteiini heiluttamassa hädissään viruksen osaa, jolloin puolustussolu huomaa tilanteen ja tuhoaa infektoituneen solun ennen kuin virus ehtii levitä.
  • Immuunigeeneistä on olemassa enemmän erilaisia versioita kuin mistään muista tunnetuista geeneistä. Ajatus on, että erilaiset pikkuproteiinit pystyvät nappaamaan ja esittelemään erilaisten pöpöjen osia. Tai ehkä jotkin pikkuproteiinit tekevät sen tehokkaammin kuin toiset. 
  • Silti yhdellä koiralla on joka geeniä vain ne kaksi kappaletta, yksi emolta ja toinen isältä peritty.* Kuten vaikka. Hachilla on immuunigeenistä 1 versiot 1A ja 1B, mutta Pochilla versiot 1C ja 1D. Tällaiseen heterotsygotiaan luonto myös näyttää pyrkivän mutta rotukoirien sisäsiitos tekee jotain ihan muuta. Oikeasti Hachilla ja Pochilla olisi varmaan molemmilla immuunigeenistä 1 pelkkää versiota 1A.    

Koiran DLA-immuunigeenialue, vähän tarkempi versio

Immuunigeenit, luokka I

Geeni 1 (139 tunnettua versiota, 1A, 1B, 1C...)

Geeni 2 (17 tunnettua versiota, 2A, 2B, 2C...)

Geeni 3 (9 tunnettua versiota, 3A, 3B, 3C...)

(Geeni 4, sijaitsee toisessa kromosomissa.)

Immuunigeenit, luokka II

Geeni 5 (1 tunnettu versio, 5A)

Geeni 6 (181 tunnettua versiota, 6A, 6B, 6C...)

Geeni 7 (30 tunnettua versiota, 7A, 7B, 7C...)

Geeni 8 (86 tunnettua versiota, 8A, 8B, 8C...)

DLA:n I ja II -luokkien geeneistä valmistuvien pikkuproteiinien erot:

I-luokkalaiset: työskentelevät kaikissa elimistön solutyypeissä ja antavat itsemurhahakuisen hälytyksen siitä, että solu on infektoitunut viruksella. Aktivoivat puolustussoluja, jotka tuhoavat infektoituneet solut.

II-luokkalaiset: työskentelevät pöpön osien esittelyyn erikoistuneissa valkosoluissa, jotka ovat itse terveitä mutta "syöneet" ympäristöstään bakteereja ynnä muuta epäilyttävää. Mitä ne sitten esittelevät. Aktivoivat puolustussoluja, jotka osallistuvat puolustautumiseen epäsuorasti esimerkiksi tuottamalla vasta-aineita. Aiheuttavat siten tulehduksen ja allergian oireet.   

Lisäksi molemmat luokat esittelevät osia koiran omista proteiineista. Normaalisti puolustussolun ei kuulu reagoida niihin. Mitä seuraa, jos puolustussolu kuitenkin reagoi? Jep, autoimmuunisairaus. DLA-pikkuproteiinit voivat olla osa häiriötä mutta tuskin koko selitys. 

Geenit sijaitsevat peräkkäisenä ryppäänä (paitsi tuo erakko 4), mutta alueella on muitakin geenejä. 

Koiran immuunigeenialue, edelliset geenit korrektisti nimettynä xD

DLA I

DLA-88 (139 tunnettua versiota, DLA-88*001:01, DLA-88*005:01...)

DLA-12 (17 tunnettua versiota, DLA-12*001:01:01, DLA-12*001:01:02...)

DLA-64 (9 tunnettua versiota, DLA-64*001:02, DLA-64*001:01:01...)

(DLA-79, sijaitsee toisessa kromosomissa)

DLA II

DLA-DRA (1 tunnettu versio)

DLA-DRB1 (181 tunnettua versiota, DLA-DRB1*001:03, DLA-DRB1*002:03...)

DLA-DQA1 (30 tunnettua versiota, DLA-DQA1*012:01:2, DLA-DQA1*014:01:2...)

DLA-DQB1 (86 tunnettua versiota, DLA-DQB1*008:03, DLA-DQB1*013:04...)

Voin sanoa, että mikään muu koiran geeneihin liittyvä juttu ei ole tuntunut yhtä hankalasti lähestyttävältä kuin DLA. Kiitos noiden järjettömien geeninimien ja niiden versionumeroinnin. Ootas kun aletaan puhua haplotyypeistä, joissa nuo esiintyvät peräkkäin...

Suosittelen omien muistisääntöjen keksimistä.

DLA-geeniversioiden yhtenäisen nimeämisen ja tietokannan ylläpitoon on perustettu eräänlainen komitea. Tietokanta löytyy osoitteesta https://www.ebi.ac.uk/ipd/mhc/group/DLA/ :

Lähes kaikilla shiboilla yhdet ja samat immuunigeeniversiot

Immuunigeenien tutkimuksissa näkee todella usein, että yksittäisen immuunigeenin sijaan on tutkittu esim. kolmen peräkkäisen immuunigeenin jonoa tietyssä rodussa. Peräkkäisten geeniversioiden jono = haplotyyppi. Esimerkiksi immuunigeenien 1, 2 ja 3 eräs haplotyyppi vois olla 1B-2A-3B. Tai vaikka 1B-2C-3B. Jos yhelläkin geenillä on eri versio, niin se lasketaan erilliseksi haplotyypiksi. Ja ihan kuten tavallisessa genetiikassa, niin koira on perinyt yhen haplotyypin emältä ja toisen isältä. Ne voi olla keskenään samanlaiset tai erilaiset.

Tässä tutkimuksessa oli kohteena kolmen DLA-geenin jono: DLA-88, DLA-12 ja DLA-DRB1. Huolimatta siitä, että näiden geenien pitäisi olla eliöpopulaation monimuotoisimmat, niin suurelta osalta shiboja löytyi tietty haplotyyppi. Se näytti the virallisilla nimityksillä tältä:

DLA-88-geenistä versio 006:01

DLA-12-geenistä versio 001:01:01

DLA-DRB1-geenistä versio 056:01

Näistä kaksi ekaa kuuluu I-luokkaan eli esittelee puolustussoluille viruksia, kolmas taas II-luokkaan ja esittelee syötyjä bakteereja. Tai muuta sisäänotettua, kuten siitepölyhiukkasen osia.

Tutkimuksen 37 shibasta 10 oli perinyt tämän versiosetin sekä emolta että isältä (homotsygootit) ja 19 toiselta vanhemmaltaan (heterotsygootit).

Tämä yleisin haplotyyppi ja kaksi muuta haplotyyppiä vastasivat noin 90% kaikesta muuntelusta, mikä tutkimuksen shiboista löytyi. Eli lähes kaikilla shiboilla oli jokin kolmesta vaihtoehdosta. Muita harvinaisempia haplotyyppejä (tyyliin yhdestä tai kahdesta koirasta?) löytyi yhteensä kahdeksan.  

Mitä jos tuo shibojen yleinen versio DLA-DRB1-geenistä toimii jotenkin huonosti esitellessään puolustussoluille potentiaalisia uhkia. Yliteholla tai aliteholla. En tarkota, että tästä on näyttöä, mutta jos olisi, niin sama ongelma ois sitten isossa osassa rotua. 

Shibojen uniikit DLA-geenit suden sukua?

Mielenkiintoinen havainto shibojen DLA-DRB1-geenistä oli se, että sen kolme yleisintä versiota (mukaanluettuna tuo yleisimpään haplotyyppiin kuuluva 056:01) olivat "yksinoikeudella shiboille", siis ettei niitä löytynyt ollenkaan muista tutkimuksen roduista. Sen sijaan kahta niistä on havaittu susissa. Esimerkiksi tuota 056:01:stä suomalaisissa susissa yleisyydellä 4.0%. Vanha National Geographic -legenda shibasta ja susigeeneistä saa yhtäkkiä tukea! : D    

Entäs se DLA-immuunigeenien ja allergioiden ja autoimmuunisairauksien yhteys?

On epäilys mutta ei vankkoja todisteita. Tyypillinen tutkimustulos näyttäisi tältä: shiballa immuunigeenin 5 versio 5C yhdistyy kohonneeseen riskiin saada atooppinen ihotulehdus. Eli vertaillaan atoopikkojen ja ei-atoopikkojen immuunigeenejä ja havaitaan, että sattumaa useammin atoopikoilta löytyy joku tietty versio. Mutta miksi, siihen on harvoin vielä vastausta. Samasta syystä ei sanota, että versio 5C aiheuttaisi atopian, koska mekanismia ei ole tutkittu saati osoitettu.

Entä mikä erottaa siitepölyallergisen koiran ja sen allergiattoman toverin?

Hyvä kysymys! Vastaus olisi myös arvokas. Kummallakin koiralla siitepölyhiukkanen on varmaankin päätynyt antigeenejä esittelevään valkosoluun, jossa II-luokan DLA-pikkuproteiini on kuljettanut siitepölyn osan näytille solun pinnalle. Valkosolu on käynyt näyttämässä Potentiaalista Uhkaa puolustussolulle, mutta vain toisella koiralla puolustussolu on aktivoitunut ja saanut siten aikaan allergian oireet. Toisen koiran puolustussolu on todennut, että väärä hälytys, kohde on vaaraton. Miksi näin, sitä ei vielä tiedetä. Varmana tapahtumasarja on monimutkainen ja siihen liittyy paljon muutakin kuin pelkkä DLA-pikkuproteiini.

Tuntuu kyllä uskomattomalta, että tollanen systeemi voi toimia niin hyvin. Miten ne solut osaa yleensä erottaa, että jonkin bakteerin proteiinipala on todellinen uhka ja siitepölyhiukkasen proteiinipala ei ole?     

Shibojen DLA-alueen geenitestaus

UC Davis -labran kaupallisesta geenitestistä on ollut aiemminkin puhetta. Testi tutkii jotakin koiran I ja II-luokan immuunigeeneistä, mutta mä en ole vieläkään onnistunut koodaamaan auki, että mitä geeniversioita tai haplotyyppejä ne yksinkertaiset numerosarjat tarkalleen kuvaa. Huomionarvoista on silti, että tuollakin on lähes kaikilla shiboilla jokin kolmesta vaihtoehdosta.

Ihmislajilla vastaavia immuunigeenien versioita on muuten löydetty noin 30 000 erilaista.    

"Opettelimme kolme versiota ja olemme jo ihan poikki! Onko se nyt varmasti DLA eikä DNA??"

Lähteitä ja luettavaa

Large-Scale Polymorphism Analysis of Dog Leukocyte Antigen Class I and Class II Genes ( DLA-88DLA-12/88L and DLA-DRB1) and Comparison of the Haplotype Diversity between Breeds in Japan (Miyamae ym., 2023)

Principles of Virology, Volume 2: Pathogenesis and Control, 5th Edition (Flint ym., 2020)

Dog leucocyte antigen (DLA) class II haplotypes and risk of canine diabetes mellitus in specific dog breeds (Denyer ym., 2020)

The canine MHC class Ia allele DLA-88*508:01 presents diverse self-and canine distemper virus-origin peptides of varying length that have a conserved binding motif (Ross ym., 2018)

Evaluation of a DLA-79 allele associated with multiple immune-mediated diseases in dogs (Friedenberg ym., 2015)

Molecular organization of the canine major histocompatibility complex (Wagner, 2003)

4

Pitkästä aikaa genetiikkaa. Inspiksenä kesäkuun alussa julkaistu paperi, jossa on tutkittu eri koiraroduille ominaista DNA:ta. Vähän kuin olisi etsitty roduista rotumerkkejä, jotka erottaa ne muista roduista, mutta genomitasolla. Ja yritetty selvittää, että selittääkö ne havaitut DNA-jutut todella rotujen ulkoisia ominaispiirteitä. Japanilaisroduista akita on ollu edustettuna, ja niistähän löytyi vaikka mitä mielenkiintoista.

Kyseessä on mielestäni japaninakita. Jälleen kerran herää kysymys, että mitä japanilaiset oikein tekivät akitalleen sodan jälkeen. Niistä molossi-seefferi-mistälie-mixeistä näyttää geenitasollakin tulleen taas uniikkeja alkukantaisia koiria.

Välikevennyksinä lisää 60/70-taitteen kiehtovia välivaiheakitoja värikuvina kirjasta (c) 日本犬 / Naotaka Hirota.

Tutkimuksen koirarotujen evoluutiopuuta. Kuvittele briardin ja chowin väliin paksu viiva niin että evoluutio alkaa chowista myötäpäivään. Kuten aiemmissa vastaavissa puissa, niin nytkin itämaiset rodut päätyvät sinne alkukantaisimpiin. Kuva (c) Li ym., 2023 10.1186/s12864-023-09390-6
PMCID: PMC10240460

Pari huomionarvoista juttua tutkimuksesta

  • Itselleni uusi termi BSGS eli breed-specific genetic signatures. Suomeksi vaikka DNA-rotumerkit?
  • Rummutan blogissa geenitestien yhteydessä yleensä sitä, että kaupallisissa testeissä etsitään pelkkiä mutaatioita eikä lueta koko geeniä. Tämä tulee muuttumaan tekniikan ekonomistuessa. Tässäkin tutkimuksessa on luettu kokonaiset genomit.
  • Tutkimuksen julkaisualusta on BMC Genomics (IF 4.558). En osaa kommentoida, vaikuttaa ok:lta.
  • Mä en ole genomiikan tai populaatiogenetiikan ammattilainen. Jos jokin asia vaikuttaa omituiselta, niin olen voinut tulkita sen väärin. Siinä tapauksessa kommenttiboksiin mars.

Lista akita-rodun ominaisista yhen kirjaimen geenimutaatioista (snipeistä), jotka saattavat vaikuttaa koko koiraan

Kaikilta tutkimuksen akitoilta (5 akitaa), mutta ei muun rotuisilta koirilta, löytyi tällainen setti yhden DNA-kirjaimen mutaatioita. Tai löytyi niitä enemmänkin, mutta nämä voi olla merkityksellisiä, koska ne 1) sijaitsevat jossain tunnetussa geenissä proteiinin valmistusohjeen kohdalla ja 2) saavat aikaan sen, että proteiinin valmistusohje muuttuu. Jolloin koko proteiinin toiminta saattaa muuttua, mikä taas voi näkyä jotenkin koirassa. Laitan proteiinien enkkunimet, helpottaa lisätietojen etsimistä.

LOC119870150: Karakterisoimaton geeni ja proteiini. Tasha-bokserin referenssigenomista havaittu proteiinioletettu. Kukaan ei vielä tiedä, mitä tämä tekee. Proteiinitietokannasta ei muuten löydy miltään muulta elukalta samankaltaista proteiinia, mikä on vähän erikoista.

ARHGEF12: Rho Guanine Nucleotide Exchange Factor 12. Tunnetaan ihmisellä. Liittyy siihen, miten solu reagoi ulkopuoleltaan tuleviin viesteihin. Liittyy myös tietynlaiseen leukemiaan.

NFX1: Nuclear Transcription Factor, X-Box Binding 1. Tunnetaan ihmisellä. Geeninsäätelyproteiini. Sitoutuu ihmisellä immuunijärjestelmän HLA-alueelle (sama kuin koirien DLA) ja estää geeniekspressiota. Saattaa siis hillitä tulehdusreaktiota. Tulee mieleen akitojen autoimmuunisairaudet... mutta silloin kaikki viisi tutkittua akitaa olisi tämän osalta mutantteja.

AQP3: Aquaporin 3. Tunnetaan ihmisellä. Kanavaproteiini, joka sijaitsee solukalvolla ja jonka läpi virtaa vettä. Ihmisellä akvaporiinin kolmosversiota löytyy munuaisten soluista.

NOL6: Nucleolar Protein 6. Tunnetaan ihmisellä. Sijaitsee solun tumassa tumajyväsessä ja liittyy ribosomien valmistukseen. Proteiini on todella samanlainen joka lajilla, joten sen toiminta on jotain elämälle keskeistä.

LOC106559783: Karakterisoimaton geeni ja proteiini. Toinen Tasha-bokserin genomin proteiinioletettu. Tutkimuksessa nimetty noin, mutta koodilla löytyy tietokannasta tarkennus Translation initiation factor IF-2-like isoform X1, eli olisi proteiinisynteesin aloituksessa toimiva proteiini.

KLKB1: Kallikrein B1. Tunnetaan ihmisellä. Veriplasman proteiini, joka kulkee epäaktiivisessa muodossaan verenkierrossa. Aktivoituu, kun tarvitaan veren hyytymistä tai tulehdusreaktiota.

EIPR1: EARP Complex And GARP Complex Interacting Protein 1. Tunnetaan ihmisellä. Proteiinin toiminta yhdistetty tuumorisuppressioon eli olisi antisyöpägeeni. Mutatoituneena yhdistyy erilaisiin kasvainsairauksiin.

SLMAP: Sarcolemma Associated Protein. Tunnetaan ihmisellä. Sarcolemma = luustolihassolujen ja sydänlihassolujen solukalvo. Proteiini on interaktiossa striatiini-proteiinien kanssa, jotka osallistuvat solussa "vähän kaikkeen". Eräs tunnettu mutaatio ihmisellä johtaa rytmihäiriösairauteen.

NIBAN3: Niban Apoptosis Regulator 3. Tunnetaan ihmisellä mutta huonosti. Saattaa liittyä ohjatun solukuoleman (apoptoosi) säätelyyn. Käyttäytyy poikkeavasti syöpäsoluissa. Akitoilla havaittu kolme aminohappomuutosta tässä samassa proteiinissa verrattuna muihin rotuihin.

JSRP1: Junctional Sarcoplasmic Reticulum Protein 1. Tunnetaan ihmisellä. Vaikuttaa lihassolujen supistumiseen, mahdollisesti säätelemällä lihassoluun tulevaa kalsiumsignaalia.

LOC119863881: Karakterisoimaton geeni ja proteiini. Tietokannassa tarkennuksena on Odorant-binding protein-like, eli liittyisi hajuhermon toimintaan ja hajuaistiin. Akitoilla havaittu kaksi aminohappomuutosta samassa proteiinissa. Sijainti X-kromosomissa.

Muut lyhyet DNA-alueet, joihin rikastunut erityisen paljon akitalle uniikkeja snippimutaatioita ja jotka on rikastuneet rodussa

Akitat ja muut itäaasialaisrodut erottuivat näidenkin suuressa määrässä muista roduista. Erona edelliseen geenilistaan on käsittääkseni se, että nämä mutaatiot sijaitsevat geenien väleissä tai proteiiniohjeiden väleissä introneissa eli eivät suoraan muuta valmistuvaa proteiinia. Sen sijaan ne voivat vaikuttaa siihen, missä ja milloin ja miten paljon proteiinia tuotetaan. Näillä suht lyhyillä DNA-alueilla on akitoilla siis 10-17 kpl mutatoituneita DNA-kirjaimia. Laitan listan isommista alueista jatkokäyttöä varten, mutta katsotaan tarkemmin noita yksittäisiä lokuksia.

Tulkintana on se, että nämä geenialueet on olleet epäsuorasti jalostusvalinnan kohteena, koska ne saavat aikaan koirassa jotain ulkoisesti havaittavaa, mistä kasvattajat ovat pitäneet. Tutkimuksessa ei oteta kantaa siihen, onko näin voinut käydä akitoilla myös sattumalta pullonkaulailmiön takia.

Alue LOC119871302-LOC102154570 (17 mutaatiota!)

Alue LOC100685738-LOC111096528

Alue LOC102152863-LOC119874118

Alue ABRA-LOC102153821

Lokus MARCHF1. Akitoilla 11 mutaatiota MARCHF1-geenin introneissa, jotka saksitaan pois lopullisesta lähetti-RNA:sta ja proteiinista. Saattavat silti vaikuttaa geenin toimintaan. Tunnetaan myös ihmisellä. MARCHF1 liimailee proteiineihin osoitelappuja, jotka ohjaavat ne kalvorakkuloihin tuhottavaksi. Mikä kiinnostavaa, niin se tekee (ihmisellä) tätä immuunijärjestelmän HLA-kompleksin tuottamille molekyyleille, eli hillitsee immuunijärjestelmän toimintaa. Ihmisten HLA on koirilla nimeltään DLA.

Lokus LOC119863881 (10 mutaatiota geenin edessä sekä 17 mutaatiota intronissa sekä yksi proteiinia muuttava mutaatio (?)) Tämä on sama hajuhermon toimintaan liittyvä geeni/proteiini kuin aiemmassa taulukossa, mutta proteiiniosan lisäksi geenin säätelyalueella näyttää kertyneen hirmuiset määrät mutaatioita. Mitä sellaista akitat haistavat mitä muut koirat ei? : D

Mutanttirotujen neljän kärki

Ne rodut, joilta kaikkiaan löytyi eniten omalle rodulleen uniikkeja snippimutaatioita, joita muilla roduilla ei ollut, olivat chow chow, akita, alaskanmalamuutti ja sussexinspanieli (!!!). Ilmiön katsotaan kuvastavan näiden rotujen geneettistä erilläänoloa muista koiraroduista.

En tiedä mitä ajatella tuosta spanielista.

Akitalla ei havaittu dramaattisia deleetioita proteiinien rakennusohjeissa

Eikä ylimääräisten osien insertioita. Muualla kuin proteiinien rakennusohjeissa lyhyitä puuttuvia tai lisääntyneitä DNA-pätkiä löytyi reippaasti. Samat neljä mutanttirotua johtivat niidenkin määrässä. Neljältä rodulta (norwichinterrieri, airedalenterrieri, chowi, berni) havaittiin jossain geenissä proteiinin rakentumiseen vaikuttava deleetio. Joko aminohappo putosi pois tai lukuraami muuttui (jolloin koko loppuosa proteiinista on sekaisin). Chowi on lähimpänä akitaa, joten laitetaan sen deleetio, jossa yksi aminohappo putoaa melko loppuosasta proteiinia pois. Kyseinen proteiini on SIPA1L1 eli signal induced proliferation associated 1 like 1. Ihmisellä sen uskotaan vaikuttavan solun tukirangan ylläpitoon sekä tekevän jotain hermosolujen synapseissa. Ehkä joku keksii vielä chowispesifin tutkimuksen, jossa selviää, mitä tuollainen deleetio proteiinin toiminnalle tekee, jos mitään. Hiirikokeissa geenin puuttuminen vaikuttaa hiirien luonteeseen, mikä on kiinnostavaa chowin kaltaisen rodun historian valossa.

Akitoilla selkeitä poikkeamia toistojaksojen määrissä

DNA:ssa esiintyvät toistojaksot on perinteinen rotukohtainen markkeri, koska niitä ilmestyy niin helposti verrattuna muihin mutaatioihin. Yleensä niitä pidetään neutraaleina, eli eivät vaikuttaisi geenien toimintaan, mutta kuka näistä säätelyalueista oikeasti tietää. Toistojakson idea: samassa kohdassa genomia on yhellä rodulla AGAGAG, toisella rodulla pelkkä AG ja kolmannella rodulla AGAGAGAGAGAGAG. Akitojen rotukohtaiset toistojaksot, jotka poikkesivat muista roduista:

PDE10A-geenin (phosphodiesterase 10A) intronissa. Tämä proteiini on todella keskeinen solun perusmetaboliassa ja signaalinvälityksessä.

NDST1-geenin ( N-deacetylase and N-sulfotransferase 1) intronissa. Jälleen perusmetabolian proteiini, joka kiinnittää heparaanisulfaattiin sen sulfaatin.

RTN1-geenin (reticulon 1) intronissa. Retikuloni 1 vaikuttaa hormoneja tuottavien solujen solukalvostossa ja liittyy siihen, miten solut erittävät hormonirakkuloita.

ZCCHC10-geenin (zinc finger CCHC-type containing 10) edessä, intronissa ja vielä takana. Lisäksi tämän geenin alueelta löytyi proteiinin rakennusohjetta muuttamattomia snippejä niin paljon, että alue mainitaan akitan uniikeimmaksi geenialueeksi. Proteiini näyttäisi liittyvän RNA:n käsittelyyn ja sitä myöten proteiinisynteesiin.

ABRA-geenin (actin binding Rho activating protein) edessä. ABRA on solukalvon monitoimiproteiini, joka liittyy mm. solusignalointiin ja geeninsäätelyyn.

LOC102155842-lokuksen intronissa. Proteiini vielä tuntematon.

Akita jakaa eniten DNA-rotumerkkejä chowin kanssa

Niistä mutaatioista, jotka ei olleet uniikkeja akitoille, löytyi eniten vastaavuutta choweilta. Itse asiassa korkeimmat samankaltaisuuslukemat rotujen parittaisissa vertailuissa on sheltillä/colliella ja akitalla/chowilla.

Mikähän selittää? Itäaasialaisuus? Alkukantaisuus?

Vaiko ehkä vanha tuttu chowiin perustuva mikawankoira. NIPPO inhosi sitä aikoinaan niin tolkuttomasti, että on koominen ajatus, jos se yhä piileksiikin japaninakitan geeneissä.

Seuraavaksi eniten samankaltaisuutta akitalla oli shar pein ja alaskanmalamuutin kanssa, sekä jonkin verran tiibetinspanielin ja sussexinspanielin kanssa. Muiden rotujen suhteen akita näyttää aika uniikilta. Ei löytynyt enää geenitason samankaltaisuutta niiden jättirotujen tai saksanpaimenkoiran kanssa, joihin akita sekoittui sodan aikana.

Johtopäätökset

Tutkimuksen idis oli lukea eri rotujen edustajien (esim. 5 akitaa) koko genomit ja etsiä DNA:sta kohtia, jotka löytyvät saman rodun kaikilta edustajilta mutta eivät muiden rotujen edustajilta. Eli tavallaan DNA-rotumerkit. Sitten katsottiin tarkemmin ne DNA-rotumerkit, jotka osuivat tunnettujen geenien kohdalle ja muuttivat siitä valmistuvaa proteiinia. Ajatuksena oli, että rodun erilainen proteiini voisi vaikuttaa rodun fenotyyppiin eli ulkoisiin rotumerkkeihin.

Akitalla löytyi selkeitä genomista DNA-rotumerkkejä, joita ei muilla roduilla ollu. Eli kaikilla viidellä akitalla on molemmissa vastingeeneissä ollut kyseinen rotukohtainen mutaatio. Nyt voi miettiä, että onko kaikilla akitoilla sama tilanne (jolloin mutaatio on fiksoitunut rotuun) vai sattumalta näillä viidellä tutkitulla.

Mutta tekeekö nuo löytyneet DNA-rotumerkit akitasta akitan, niin että ne on olleet jalostusvalinnan kohteena? Akitathan on käyneet läpi hitonmoisen pullonkaulan, jossa käsittääkseni katosivat mm. kaikki muut A-lokuksen värit kuin punainen. Silloin jonkun säästyneen kantakoiran mutaatio on voinut levitä koko rotuun automaattisesti.

Useimmat noista "kandidaattigeeneistä" on mun mielestä liikaa solun ja monisoluisen eliön perusmetaboliaan liittyviä. Suurin osa koirankin geeneistä liittyy siihen, että yksittäinen solu voi toimia. Tai siihen, että kyseessä on elinkelpoinen koira. Rotugeenejä on tosi vähän. Vaikea uskoa, että akitoilla olisi jokin rotukohtainen proteiinisynteesi, joka näkyisi ulkomuodossa.

Sitten se kiinnostava osuus. Kuitenkin aika lyhyt lista hittejä, ja silti tuli vastaan kahdesti jotain immuunijärjestelmän toimintaan linkittyvää. Sattumaa vai merkityksellistä rodussa, jossa ongelmana on immunologiset sairaudet? Voiko nuo akitojen versiot NFX1- ja MARCHF1-lokuksista altistaa autoimmuunisairauksille? Ja onko ne todella tollaset koko rodussa. Jos mulla olisi geenilabra, niin tutkisin näitä : D Jotain muutakin sairastumiseen silti tarvitaan, koska muuten kaikki nuo viisi olisivat olleet AI-sairaita. Tutkimuksessa ei mainita koirien taustatiedoista kovin selkeästi. Osa näytteistä on tullut eläinlääkärikäyntien yhteydessä otetuista verikokeista. Luulisi kyllä, että ovat kontrolloineet asian ja ottaneet mukaan sillä hetkellä perusterveitä koiria. Tutkimuksen akitat oli 1 x uros ja 4 x narttua.

Kaikista tutkimuksen roduista löytyi lopulta kolme painavampaa DNA-rotumerkkiä, joista uskaltaa spekuloida jotain. Näissä proteiini oli pahemmin "pilalla" kuin yhen aminohappomuutoksen verran. Berninpaimenkoiralla se on jokin kylmään ilmanalaan sopeutumiseen linkittyvä proteiini. Chowilla jo mainittu proteiini, joka voi liittyä hermostoon ja luonteeseen. Ja samojedilla jokin niveltulehdusta hillitsevä proteiini, mikä sopii sen rekikoirataustaan. Kuulostaa ehkä vaatimattomalta tässä vaiheessa, mutta tutkimus on mielestäni oikein hyvä pioneeritutkimus --> "This study will stimulate new thinking."

Lähteitä ja luettavaa

Systematically identifying genetic signatures including novel SNP-clusters, nonsense variants, frame-shift INDELs, and long STR expansions that potentially link to unknown phenotypes existing in dog breeds (Li ym., 2023)

Geenin ja proteiinien ominaisuudet: NIH/National Library of Medicinen tietokannat

4

Japanilaisten shibakirjojen innoittamana katsaus shiban lyhytvarvasanomaliaan. 80-luvun näyttelyshibojen kuvissa tulee vastaan yllättävän monia etukäpäliä, joissa voi kuvitella näkevänsä lyhentyneitä reunavarpaita. Käpälän asento ja kuvakulma toki vaikuttaa siihen, miltä varpaat näyttää.

Riippumatta siitä onko nämä nimenomaiset varpaat todellisuudessa anomaalisia vai ei, niin shiboissa esiintyy lyhytvarpaisuutta. Myös Suomessa, koska aiheesta oli taannoin juttu Shibasanomissa. Jos nyt on niin, ettei poikkeavat varpaat Japanissa ole estäneet koiran palkitsemista näyttelyssä (ainakin oikean yläkulman käpälä näyttää oikeasti vähän omituiselta) niin onko se ihme, jos lyhytvarpaisuus on säilynyt rodussa.

Lyhytvarpaisuus ja lyhytsormisuus eli brakydaktylia tunnetaan myös ihmisillä ja on hyvin karakterisoitu ilmiö. Jokin varpaan/sormen luuosista ei kasva normaalisti tai puuttuu kokonaan, jolloin varvas/sormi jää muita lyhyemmäksi. Ominaisuutta aiheuttavia geenivirheitä on tunnistettu monia, ja niistä useimmat periytyvät joko dominoivasti tai dominoivasti epätäydellisellä penetranssilla (jolloin voi käydä vaikka niin, että mummolla, isällä ja lapsenlapsella on kaikilla sama peritty geenivirhe mutta vain mummolla ja lapsenlapsella se ilmenee lyhyenä sormena).

Sitten koirien varvasanomaliatutkimusten pariin!

...

Joita ei ole olemassa.

Oikeasti. Olisin kuvitellut, että nämäkin koiran luuston osat olisivat olleet kiinnostava tutkimuskohde, etenkin kun niissä selvästi esiintyy sitä houkuttelevaa poikkeavuutta normaalin lisäksi. Harkitsin jo, että laitan aprillipäivänä varvasnivelten röntgenin uudeksi PEVISA-terveystarkiksi. Löytämäni koirien brakydaktyliaa käsittelevät tai edes sivuavat tutkimukset on tässä:

On ollut vuosi 1957, ja lyhytvarpaisten mutanttikoirien stokki on ollut tarjolla tutkimuksiin. Näyttää siltä, ettei näistä koskaan julkaistu tutkimusta. Periytymistavaksi mainitaan resessiivinen, mutta ken tietää. Silti, mielenkiintoinen löytö tieteen historiasta.

Sitten hypätään vuoteen 2021, ja löytyy paperi nimeltä Four Unusual Cases of Congenital Forelimb Malformations in Dogs. Neljä kuvailtua eturaajaa on jo selvästi epämuodostuneita, mutta lyhytvarpaisuus mainitaan yhtänä esimerkkinä asioista, joista on tarjolla surkean vähän tietoa tai tapauskertomuksia. Siis että toissavuonna oli asia vielä näin.

Yksittäinen tapauskertomus Symmetrical brachydactyly in a dog vuodelta 2017 kuvailee Maremmano-abruzzese -rotuisen koiran, jonka käpälistä on lyhentyneet kaikki "kämmentä" ja sormia vastaavat luut.

Ja 2016 oli kuvailtu kolme erilaista käpälän epämuodostumaa Congenital deformity of the distal extremities in three dogs. Yksi epämuodostumista näytti päälle päin vain lyhytvarpaisuudelta mutta röntgenkuvan perusteella olikin kasvanut kaksi varvasta yhteen. Jälleen on korostettu sitä, että käpälän ja varpaiden kasvuhäiriöiltä puuttuu koirilla yhtenäinen ja selkeä nimeäminen ja luokittelu.

Siinä ne taisi olla. Kaikissa on kuvailtu, miltä näyttää yksittäisten koirien epämuodostuneet käpälät röntgenkuvassa. Ei ole olemassa geenitutkimusta, perinnöllisyystutkimusta tai tietyn rodun varvasanomalian yleisyyttä selvittänyttä tutkimusta. Science, you fail. Onko koirien varpaat todella niin mitätön aihe? Tuntuu hölmöltä, että koirien värejä, joilla ei ole yleensä mitään merkitystä niille itselleen, kyllä tutkitaan innokkaasti.

Koska tiede tuotti pettymyksen, niin käännytään varvasanomaliaa nähneiden koiraharrastajien puoleen. Snautsereilla ja pinsereillä lyhyet varpaat näyttää olevan tuttuja. Kääpiöpinserien uusimmassa JTO:ssa mainitaan rodun varvasanomaliasta, että

  • Luovutusikäisessä pennussa anomalia ei vielä näy vaan käy ilmi 3-6 kk iässä, kun varvas jää kasvussa muista jälkeen.
  • Anomalian vakavuusaste [tulkitsen, että varpaan lyhyys] vaihtelee ja voi pahimmillaan vaikuttaa koiran liikkumiseen, altistaen myös nivelrikolle.
  • Pidetään perinnöllisenä mutta periytymistapa ei ole tiedossa.

Ajattelin, että mulla olisi enemmän sanottavaa aiheesta. Mainitut tutkimukset löytyy otsikot googlaamalla, ja lisäluettavaa kannattaa enemmin etsiä eri rotujen kasvattajien ja harrastajien parista. Googlessa short toe anomaly dog toimii paremmin kuin brachydactyly.

2

Värikarttasarjan päättää shiban värigenetiikan kummallisin ilmiö. Voiko kahdelle bläkkärille shiballe, tai ainakin bläkkäriltä näyttävälle shiballe, syntyä punainen jälkeläinen? Bläkkärihän ei voi nykyisen värigenetiikkaopin mukaan kantaa punaista, joten lähtökohtaisesti kyseessä on ns. käräytysväri. Jokin toinen uros on ollut salaa asialla. Tai emo on adoptoinut paperilla toisen emon pennun, joskin ensinnä mainittu lienee se yksinkertaisin selitys.

Kaunis punainen sashige-shiba 80-luvun Japanista. Kuvituskuva, ei liity asiaan (c) Japanilaiskoiran valokuvakirja 3.


Näistä mahdottomista punaisista kuulee toisinaan. Ja siitä, että polveutumismääritykset olisivat silti täsmänneet. Olisin taipuvainen ajattelemaan, ettei niin ilmiselvää ja epäilyksiä herättävää asiaa pentutuotannossa möhlitä, jos koirat kuitenkin rekisteröidään. Jossakin kohdassa shibojen sukupuusivustolla on joskus ollut sukulinja, jonka useammassa sukupolvessa on ilmestynyt mahdoton punainen. Muistan tähän liittyen seesamishibojen ryhmästä kommentin, että jonkin japanilaiskasvattajan mukaan (= nähnyt varmana valtavan määrän pentueita) joskus, hyvin harvoin, syntyy bläkkärivanhemmille punainen pentu.

Punainen shiba 80-luvun Japanista. Kuvituskuva, ei liity asiaan (c) Japanilaiskoiran valokuvakirja 3.


Edelleen se luonnollinen selitys on myös todennäköisin selitys, mutta mitä jos kaksi bläkkäriä voi oikeasti saada punaisen jälkeläisen, koska geeneissä on meneillään jotain omituista? Pohditaan tätä optiota. Lähtökohdat on seuraavat:

  1. Punaisessa pennussa pitää olla vähintään yksi A-lokuksen geeni, jota luetaan niin aktiivisesti, että geenituotetta syntyy niin paljon, että pigmenttikytkin on yleensä punapigmentin asennossa.
  2. Ikinä ei saa aliarvioida A-lokusta tai luulla, että nykyinen geenitietämys olisi tässä. Koko A-lokuksen luokittelusysteemi muuttui äsken, ja sekin on vaan tämän hetken luokittelusysteemi.
  3. Puhun punaisesta, mutta molemmat seesamit on samalla idealla mahdottomia värejä kahdelle bläkkärille.
  4. Ilmiön pitää olla yleistettävissä muidenkin koirarotujen värigenetiikkaan.
  5. "Geeni" tarkottaa tässä yleensä geenimuotoa/alleelia.

No niin, pentulaatikkoon ilmestyy punanen pentu, vaikka emo ja isä on bläkkäreitä. Polveutuminen täsmää tuhannen markkerin tarkkuudella, joten emo ja isä todella on bläkkäreitä. Mitä tapahtui?

Pennussa tai toisen vanhemman sukusoluissa on tapahtunut mutaatio, joka muuttaa A-lokuksen bläkkäristä punaiseen


Tämä tietty tulee ekana mieleen. Selitys mallia teoriassa mahdollinen. Ongelmana on se, että bläkkäri on "rikki" ja punanen "ehjä". Bläkkäri on mennyt rikki, kun geenistä on pudonnut pois pätkä DNA:ta. Korjaavan mutaation pitäisi kai sattumalta lisätä juuri se DNA takaisin juuri siihen kohtaan. On aina helpompi rikkoa millä tahansa tavalla kuin korjata tietyllä tavalla.


Erittäin epätodennäköinen selitys.

Bläkkärivanhemman genotyyppi on punainenbläkkäri/bläkkäri


…ja toisen vastinkromosomin punainenbläkkäri erkaantuu sukusolujen muodostuessa siten, että tuloksena on punaista ja bläkkäribläkkäriä eri sukusoluihin. Ilmiö ei ole IHAN hatusta vedetty, koska vanhalla A-lokuksen markkerisysteemillä oikeasti löydettiin samoista koirista punaisen ja bläkkärin markkerit yhdessä (peräkkäin?) siten, että genotyypin merkintä oli esim. outo Ayt/at. Yhellä kainkoiralla näin moisen testituloksen, eli esiintyi myös japanilaisroduissa. Mulle jäi epäselväksi, mikä tämän käytännön merkitys lopulta oli, ja miltä vanhat markkerifuusiot näyttäisi, jos niistä katottaisiin uusia käynnistysalueita.


Sukusolujen muodostuessa vastinkromosomit myös vaihtavat osia, joten. Periaatteessa. On olemassa biologinen mekanismi, jolla se fuusiopunabläkkärin punainen voisi joskus (hyvin, hyvin harvoin) irrota sukusoluun itsenäiseksi. Sitten sen pitäisi vielä olla ehjä toimiva geeni, ja vapautua siitä lukituksesta, mikä sitä onkin estänyt toimimasta ja näkymästä siinä bläkkärivanhemmassa. Niin ja juuri siitä uniikista sukusolusta pitäisi vielä kehittyä se pentu! : D


Olin aiemmin sitä mieltä, että jos jokin selitys mahdottomille punaisille pennuille oli, niin se liittyi jollakin tavalla näihin fuusiojuttuihin. Harmi jos promoottoritutkimus nyt torppasi koko lähestymistavan ja projekti on pistetty jäihin.


Periaatteessa ehkä oikeilla jäljillä.

Punainen shiba 80-luvun Japanista. Jo toinen kerta, kun lyhytvarvasanomalialta näyttävä varvas esiintyy näyttelyshibojen valokuvakirjassa. Kuvituskuva, ei liity asiaan (c) Japanilaiskoiran valokuvakirja 3.

Bläkkärivanhempi onkin geneettisesti punainen - jokin blokkaa punaisen käynnistysalueen


Tällaiseen skenaarioon viittasi alun tai ainakin näyttävät bläkkäreiltä. Jos punaiselle ominainen käynnistysalue on pinnallisesti lukittu (solussa on oikeasti tällekin mekanismi), A-lokus voisi ehkä toimia puoliteholla kuin bläkkärillä. Mutta lukituksen pitäisi purkautua sukusolujen muodostuessa, että punainen voisi ilmetä pennussa. Miksi niin ei tapahtunut jo silloin, kun bläkkärivanhempi itse oli vasta muodostumassa?


Erittäin epätodennäköinen selitys.

Punainen pentu on oikeasti valkoinen


Shibat ja muut japanilaiset on omituinen poikkeus siinä, että resessiivinen punainen näyttää niillä valkoiselta. On olemassa rotuja, joissa ei pysty punaisen sävystä erottamaan, onko ne E-lokuksen resessiivisiä punaisia (e/e) vai A-lokuksen dominanttikeltaisia (DY/mikätahansa). Opin taannoin että Koiraperheen elämää -kirjassa ne Honeyn "keltaiset" pennut on molempia. Jos bläkkärivanhemmat shibat on ollu valkosen kantajia ja niillä on jokin resessiivisen punasen sävyn punaseen muuttava geeni, niin valkonen pentu syntyy punaisena. En tiiä, voiko urajiroa muodostua resessiiviseen punaiseen etenkään jos A-lokus on pelkkää bläkkäriä, ja tämmösellä punaisella ei sitten voi olla turkissa yhtään mustaa pigmenttiä. Geenitestissä se olisi e/e BB/BB.


Eli tässä tapauksessa lähtökohta nr. 1 olisi väärä eikä A-lokus liity asiaan.


Plausible?

Bordercolliepentuja, jotka olisivat shiboina punaisia ja valkoisia. Kuvaesimerkki kirjasta Koiraperheen elämää (c) Jane Burton ja Michael Allaby.

Jokin muu, mikä?


Samalla linjalla kuin edellinen. A-lokus ei koskaan korjaudu bläkkäristä punaiseksi, mutta jokin toinen tekijä muuttuu ja alkaa säädellä pigmenttikytkintä samalla tavalla. Dominantin mustan aiheuttaja on yks tällanen kytkinmaanikko, joten miksi niitä ei voisi olla enemmänkin. Ongelmaksi nousee se, että mutaation pitäisi tapahtua joka kerta uudestaan, kun bläkkäri x bläkkäri johtaa punaiseen jälkeläiseen. Toisaalta geeneissä voi olla epätavallisen mutaatioherkkiä alueita.

Tunnetuista värilokuksista B-lokus voisi saada aikaan mustan pigmentin muuttumisen ruskeaksi, jolloin bläkkäripentu voisi näyttää punaiselta. Tällöin molempien vanhempien pitäisi olla resessiivisen ruskean geenin kantajia (genotyyppi B/b), jolloin pikku-b olisi kulkeutunut jostain muusta rodusta shiboihin, tai vaihtoehtoisesti olisi tapahtunut uusi mutaatio, joka muuttaa B-geenin toiminnan. Ruskean pennun molemmissa vastingeeneissä pitäisi olla mutaatio, mikä komplisoi tilannetta epäuskottavaksi. Lisäksi (maksan)ruskeat koirat muissa roduissa vaatii mielikuvitusta, että niitä oikeasti voisi sekoittaa punaiseen.


En keksi just nyt muita selityksiä. Vähiten järjetön on mielestäni tuo punainen valkonen, koska ne sentään tunnetaan muissakin roduissa. Saako muiden rotujen bläkkärit ikinä punaselta näyttäviä pentuja, joita E-lokus ei selitä? Kannattaa kiinnittää huomiota myös brindleen. Se on oikeasti vielä hämärämpi kuin merle. Siinä vaiheessa kun brindleen saadaan vihdoinkin selvyys, saattaa ratketa muutama muukin erikoinen genetiikan ilmiö.

Päivitys: Mitä jos rodussa on aiemmin ollut melko yleisenäkin punainen e/e-väri, joka selittäisi ne vaaleanpunaiset (usuaga) shibat? Jos sävy näyttää vaalealta punaiselta shibalta, niin se selittäisi samalla ehkä myytin, jossa valkoiset jalostuskoirat haalistavat punaisia shiboja. Ne ei ole ollukaan oikeasti haaleita punaisia vaan geneettisiä valkoisia, mutta niitä on syntynyt useammin.

Väriristeytykset jatkuvat. Miten suuri todennäköisyys jokaisella yksittäisellä pennulla on olla tietyn värinen, kun vanhempien E-lokus ja A-lokus tunnetaan? A-lokuksen osalta kartassa on käytössä uudempi luokittelu, joka erottaa punaseesamit punaisista.

E-lokus: E = värillinen, e = valkoinen

A-lokus: DY = punainen, SY = punaseesami, AG = mustaseesami, BB = black & tan

Viimeisessä värikartassa bläkkäriristeytyksiä. Japanilaisen sanonnan mukaisesti "mustat ja valkoiset on lähimpänä toisiaan." Shiballa bläkkäri voi kantaa vain bläkkäriä ja valkoista, joten jälkeläisten värivaihtoehtoja on tasan ne kaksi.

Kaksi tummaa bläkkäriä saa 100% tummia bläkkäripentuja. Valkoisen shiban yhteydessä sivuttiin S-lokusta ja valkokirjavuutta eli pintoväritystä, joka johtuu pigmentin puuttumisesta. En ole huomioinut sitä värikartoissa muuten, mutta kahden tumman bläkkärin epäilyttävän valkolaikkuiset pennut johtuisivat pintogeenien esiintulosta kuten muillakin väreillä. Rintaan osunut pigmentitön valkoinen laikku voi näyttää urajirolta.

Tumma bläkkäri ja valkoista kantava bläkkäri saa 50/50 tummia ja "valkoisempia" bläkkäripentuja. Valkoisen kantaminen ei oikeasti vaikuta bläkkärin mustan värin mustuuteen kuten esimerkkikoirien kuvissa on epähuomiossa tapahtunut, vaan valkoisen kantajalla on pennusta asti isommat valkoiset alueet.

Kaksi valkoista kantavaa bläkkäriä saa tummia bläkkäreitä, "valkoisempia" bläkkäreitä sekä valkoisia pentuja. Valkoinen on geneettisesti bläkkäri valkoisensa alla.

Shibat ovat nyt risteytyneet A-lokuksensa tunnettujen värien osalta kaikilla mahdollisilla tavoilla. Värivaihtoehdot löytyvät värikartat-kategoriasta.

Tumma bläkkäriä kantava punaseesami ja bläkkäri saa 50/50 itsensä kaltaisia punaseesameja ja bläkkärejä pentuja.

Mustaseesamia kantava punaseesami ja bläkkäri saa 50/50 punaseesameja ja mustaseesameja pentuja. Kaikki pennut kantavat bläkkäriä.

Taikaristeytys, jossa vaalea tuplapunaseesami ja bläkkäri saa 100% tummia punaseesamishiboja.

Yleinen risteytys, jossa bläkkäriä kantava mustaseesami ja bläkkäri saa 50/50 mustaseesameja ja bläkkäreitä pentuja.

Tuplamustaseesami ja bläkkäri saa 100% mustaseesamipentuja, jotka kantavat bläkkäriä.

Kun toinen vanhempi kantaa valkoista (genotyyppi E/e)

A-lokuksen värit säilyvät ennallaan, mutta joka pennulla on 50% todennäköisyys olla myös valkoisen kantaja. Mustaseesamilla ero on yleensä selvä ja näkyy laajempana urajirona. Valkoisen kantamisen vaikutus punaseesamiin on vielä huonosti tunnettu.

Kun molemmat vanhemmat kantavat valkoista (E/e x E/e)

A-lokuksen värit säilyvät ennallaan, mutta joka pennulla on 50% todennäköisyys olla valkoisen kantaja, 25% todennäköisyys olla olematta valkoisen kantaja ja 25% todennäköisyys siihen, että A-lokuksen väri peittyy valkoisen värin alle.

Väriristeytykset jatkuvat. Miten suuri todennäköisyys jokaisella yksittäisellä pennulla on olla tietyn värinen, kun vanhempien E-lokus ja A-lokus tunnetaan? A-lokuksen osalta kartassa on käytössä uudempi luokittelu, joka erottaa punaseesamit punaisista.

E-lokus: E = värillinen, e = valkoinen

A-lokus: DY = punainen, SY = punaseesami, AG = mustaseesami, BB = black & tan

Vitososassa seesamien keskinäiset suhteet. Vaaleampi punaseesami periytyy vallitsevasti. Tosielämässä näistä risteytyksistä on varmaan aika vähän kokemusta.

Kun kumpikaan vanhempi ei kanna valkoista

Kaksi "tavallisinta" punaseesamia, jotka kantavat molemmat bläkkäriä, saa tummempia ja vaaleampia punaseesameja sekä bläkkäreitä pentuja.

Kaksi punaseesamia eri kantajuuksilla (bläkkäri ja mustaseesami, näitä ei ilmeisesti voi erottaa päälle päin) saa tummempia punaseesameja, vaaleampia tuplapunaseesameja sekä mustaseesameja pentuja.

Bläkkäriä kantava tummempi punaseesami ja vaaleampi tuplapunaseesami saa vain 50/50 kaltaisiaan pentuja.

Sama tässä, eli mustaseesamia kantava tummempi punaseesami ja vaaleampi tuplapunaseesami saa 50/50 kaltaisiaan pentuja.

Mustaseesamia kantavat punaseesamishibat saavat tummempia punaseesameja, vaaleampia tuplapunaseesameja sekä tuplamustaseesameja pentuja.

Kaksi vaaleaa tuplapunaseesamia saa vain kaltaisiaan tuplapunaseesameja pentuja.

Punaseesamin ja mustaseesamin risteytys, kun molemmat kantavat bläkkäriä, tuottaa tummia punaseesameja, mustaseesameja sekä bläkkäreitä pentuja.

Bläkkäriä kantava punaseesami ja tuplamustaseesami saa 50/50 punaseesameja ja mustaseesameja pentuja.

Mustaseesamia kantava punaseesami ja bläkkäriä kantava mustaseesami saa 50/50 punaseesameja ja mustaseesameja pentuja.

Vaalea tuplapunaseesami ja bläkkäriä kantava mustaseesami saa 100% tummia punaseesamipentuja.

Kaksi eri lajista "superseesamia" saa 100% tummia punaseesameja pentuja, jotka kaikki kantavat mustaseesamia.

Kahden mustaseesamin risteytys, kun molemmat kantavat bläkkäriä, tuottaa mustaseesameja ja bläkkäreitä pentuja.

Kaksi mustaseesamia, kun toinen kantaa bläkkäriä ja toinen mustaseesamia, saa 100% mustaseesameja pentuja.

Kaksi supermustaseesamia saa 100% kaltaisiaan pentuja.

Kun toinen vanhempi kantaa valkoista (genotyyppi E/e)

A-lokuksen värit säilyvät ennallaan, mutta joka pennulla on 50% todennäköisyys olla myös valkoisen kantaja. Mustaseesamilla ero on yleensä selvä ja näkyy laajempana urajirona. Valkoisen kantamisen vaikutus punaseesamiin on vielä huonosti tunnettu.

Kun molemmat vanhemmat kantavat valkoista (E/e x E/e)

A-lokuksen värit säilyvät ennallaan, mutta joka pennulla on 50% todennäköisyys olla valkoisen kantaja, 25% todennäköisyys olla olematta valkoisen kantaja ja 25% todennäköisyys siihen, että A-lokuksen väri peittyy valkoisen värin alle.